Skip to content

Output files

Namaste includes a handful of processing steps, each using a few bioinformatics tools to get the job done. All of these tools generate output files, yielding a plethora of files in your results/ directory!

Below is a description of the most relevant files.

1. Preprocessing

As described in preprocess, raw reads are quality filtered, producing a file with high-quality reads and a report.

The quality-filtered reads are written to the directory results/filtered_reads/, for example:

$ ls results/filtered_reads/
ERR10188468.fastq.gz  SRR16329143_1.fastq.gz  SRR17232957_1.fastq.gz

Each of these files will be slightly smaller than the original, raw read file.

For each sample, there will be a JSON and an HTML report of the filtering process, of which the 'summary' part is parsed for later use. These files are saved under results/read_qc/ and results/read_qc/summary/.

$ ls results/read_qc/summary/
ERR10188468.json  SRR16329143_1.json  SRR17232957_1.json

As an example, these files look like:

$ cat results/read_qc/summary/ERR10188468.json
{
        "summary": {
                "fastplong_version": "0.2.2",
                "before_filtering": {
                        "total_reads":1295276,
                        "total_bases":4898452401,
                        "q20_bases":1985830150,
                        "q30_bases":644728976,
                        "q20_rate":0.405399,
                        "q30_rate":0.131619,
                        "read_mean_length":3781,
                        "gc_content":0.411915
                },
                "after_filtering": {
                        "total_reads":490786,
                        "total_bases":1801486902,
                        "q20_bases":899296433,
                        "q30_bases":331205707,
                        "q20_rate":0.499197,
                        "q30_rate":0.183851,
                        "read_mean_length":3670,
                        "gc_content":0.388144
                }
        }
}

Finally, read quality control (QC) statistics are collected for all samples and stored in a CSV format table: results/read_qc_summary.csv. It summarises the number of reads and basepairs before and after quality filtering, as well as some other quality indicators:

$ head -2 results/read_qc_summary.csv
sample,before_total_reads,before_total_bases,before_q20_bases,before_q30_bases,before_q20_rate,before_q30_rate,before_read_mean_length,before_gc_content,after_total_reads,after_total_bases,after_q20_bases,after_q30_bases,after_q20_rate,after_q30_rate,after_read_mean_length,after_gc_content
SRR17232957_1,315586,1285925859,769615133,342928711,0.598491,0.266678,4074,0.507556,263485,1083609370,696137892,320329347,0.642425,0.295613,4112,0.50747

2. Assembly

The assembly itself generates sequences in fasta format along with a tab-separated table with basic statistics per contig. These are stored under results/assembly/{sample}/ where {sample} indicates the base file name of the raw reads file that was used to generate it. As described in assembly, Namaste uses Flye to assemble reads, which generates many different output files. For convenience, we only show the relevant ones.

$ ls -F results/assembly/SRR17232957_1/
assembly.fasta  assembly_info.txt    mapped_back/

$ head -2 results/assembly/SRR17232957_1/assembly_info.txt
#seq_name       length  cov.    circ.   repeat  mult.   alt_group       graph_path
contig_1702     65004   6       N       N       1       *       *,1702,*

The assembly_info.txt file contains useful information such as contig length, depth of coverage (cov.) and whether the contig is circular (circ.). Output files from Flye are also described on its GitHub page.

Furthermore, Namaste maps reads back to contigs, which can be found in the subdirectory mapped_back/.

$ ls results/assembly/SRR17232957_1/mapped_back/
SRR17232957_1.bam  SRR17232957_1-coverage.tsv

$ head -2 results/assembly/SRR17232957_1/mapped_back/SRR17232957_1-coverage.tsv
#rname  startpos        endpos  numreads        covbases        coverage        meandepth       meanbaseq       meanmapq
contig_1        1       17948   33      17948   100     4.92378 22.1    57.5

Per sample coverage files are generated with samtools coverage and are slightly different from the assembly_info.txt by Flye in terms of values reported (depth of coverage = meandepth).

Finally, these per sample coverage files are combined into one file for all samples: results/contig_coverage.tsv.

$ head -2 results/contig_coverage.csv
Sample,Contig,startpos,endpos,numreads,covbases,coverage,meandepth,meanbaseq,meanmapq
SRR17232957_1,contig_1,1,17948,33,17948,100,4.92378,22.1,57.5

And the coverage statistics of both Flye and samtools are combined in one overall statistics file: results/assembly_stats-concatenated.tsv.gz.

$ zless results/assembly_stats-concatenated.tsv.gz | head -3
sample  contig  contig_length   contig_depth_flye       circular        contig_mapped_percent   contig_depth_samtools   contig_mapped_reads
SRR17232957_1   contig_1702     65004   6       N       100     6.54354 207
SRR17232957_1   contig_515      63366   6       N       100     5.86153 150

3. Antibiotic resistance genes

Screening of antibiotic resistance genes (ARGs) is done with KMA, the output files of which are briefly described on its GitHub page. Namaste uses the files with .frag.gz and .res extension, which are tabular files of hits per contig and per sample, respectively.

Files for the contig-based screening of ARGs are stored in results/resistance_genes/. Note that the .frag.gz file includes complete sequences, which quickly becomes unwieldy when using contigs as input.

$ zless results/resistance_genes/SRR17232957_1.hmm.frag.gz | head -2
GTATCTGAACAACTATCTTGTGTGGAATAACCTTGTAAATTACGCCAAAGAAAGCGACATGGAGAAAAGGAACATCTTCTTAACTTTCGTTTTGGCAACATTGAAAACTGCTAAATGCAGAGATTTATCAAACAGACCAGCAGTTCCTCTGGTCGCCTAATTAGAATTTGTGGAGATGATAAGATGGTCAATATAACAGATGTAAAACAGATTCTTCAATTTGCAATAGATGCGGAGATTAAAGTCTTTCTTGATGGTGGCTGGGGTGTAGATGCTCTTCTTGGATATCAGTCAAGAGCCCATAATGATATTGACATTTTTGTAGAAAAGAACGATTATCAGAACTTTATAGAAATAATGAAAGCTAATGGCTTTTATGAGATTAAGATGGAATATACAACATTGAACCATACTGTATGGGAAGATTTGAAAAACAGAATTATTGATTTGCATTGTTTTGAATATACGGACGAAGGTGAAATTCTTTATGATGGGGATTGTTTTCCGGTAGAAACTTTTTCGGGTAAAGGAAGAATTGAGGAAATAGAGGTTTCCTGTATTGAACCATATAGTCAAGTAATGTTCCATCTGGGATACGAGTTTGATGAAAATGATGCACATGATGTGAAGTTATTGTGTGAGACACTTCATATCGAAATTCCAAATGAGTATAGATAACTGCAAATAACAAGTTTGTAGGGGAGTTCTGATACTCCCCTATAAAAATGGCTATTTATCAACTGTTTGTTGTGACATAGCCTTTCATATAATATATCTTTGCATGGATTCCACGGGCCTTACTCCGTGTGTTTTTGCGAATCCACGATAACTCTTCAGGTCGCTCGACCTTCAAAATTACCATGC        1       471     0       495     lnu(C)_1_AY928180       contig_418      4000    4864
AAGATGGTCAATATAACAGATGTAAAACAGATTCTTCAATTTGCAATAGATGCGGAGATTAAAGTCTTTCTTGATGGTGGCTTCTGGGGTGTAGATACTCTTCTTGGATATCAGTCAAGAGCCCATAATGATATTACGACATTTTGTAGAAAAGAACGATTATAAAGGGCACTTTATAGAAATAATGAAGCTAATGGCTTTTATGATTAAGATGGAATATACAACATTGAACCATACTGTATGGGAAGATTTGAAAAACAGACAATGATTTGCATTGTTTTGAATATACGGACGAAGGTGAAATTCTTTATGATGGGGATTGTTTTCCGGTAGAAACTTTTTCGAGGTAAAGGGAAGAATTGAGGAAATAGGGGTTTCCTGTATTGAACCATATAGTCAAGTAATGTTCCATCTGGGATACGGAAGTTTGATGAAAATGATGCACATGATGTGAAGTTATTGTGTGAGACACTTCATATCGAAATTCCCAATGAGTATAGATAACTACCAAATAACAAGTTTGTAGGGGAGTTCTGATACTCCCCTATAAAGAAAACAACATTTATCAACTGTTTGTGTGAGCACAGCCTAAAAAAAATACCTTGCCATCGACAGGGGTATTTTTGTTGACAGTAGCAATACTTAATCTTTGTATATTTCGTGGAGCTCTACCCTCGTAGATAATCGGGGCGTAGCGC  1       406     0       495     lnu(C)_1_AY928180       contig_1422     15104   15802

$ head -2 results/resistance_genes/SRR17232957_1.hmm.res
#Template       Score   Expected        Template_length Template_Identity       Template_Coverage       Query_Identity  Query_Coverage  Depth   q_value p_value
lnu(C)_1_AY928180            901               1             495           99.19          102.42           96.84           97.63            2.02          896.92        1.0e-26

Contigs in which the ARGs are masked are written back to the assembly folder: results/assembly/{sample}/assembly_ARG_masked.fasta.

For reads, the results are written to results/resistance_genes-reads/.

$ head -2 results/resistance_genes-reads/SRR17232957_1.hmm.res
#Template       Score   Expected        Template_length Template_Identity       Template_Coverage       Query_Identity  Query_Coverage  Depth   q_value p_value
lnu(C)_1_AY928180           7599              21             495           99.19          100.00           99.19          100.00           19.28         7535.38        1.0e-26

$ zless results/resistance_genes-reads/SRR17232957_1.hmm.frag.gz | head -2
AAAGATGGTCAATATAACAGATGTAAAACAGATTCTTCAATTTGCAATAGATGCGGAGATTAAAGTCTTTCTTGATGGTGGCTTCTGGGGTGTAGATACTCTTCTTGGATATCAGTCAAGAGCCCATAATGATATTACGACATTTTGTAGAAAAGAACGATTATAAAGGGCACTTTATAGAAATAATGAAGCTAATGGCTTTTATGATTAAGATGGAATATACAACATTGAACCATACTGTATGGGAAGATTTGAAAAACAGACAATGATTTGCATTGTTTTGAATATACGGACGAAGGTGAAATTCTTTATGATGGGGATTGTTTTCCGGTAGAAACTTTTTCGAGGTAAAGGGAAGAATTGAGGAAATAGGGGTTTCCTGTATTGAACCATATAGTCAAGTAATGTTCCATCTGGGATACGGAAGTTTGATGAAAATGATGCACATGATGTGAAGTTATTGTGTGAGACACTTCATATCGAAATTCCCAATGAGTATAGATAACTACCAAATAACAAGTTTGTAGGGGAGTTCTGATACTCCCCTATAAAGAAAACAACATTTATCAACTGTTTGTGTGAGCACAGCCTAAAAAAAATACCTTGCCATCGACAGGGGTATTTTTGTTGACAGTAGCAATACTTAATCTTTGTATATTTCGTGGAGCTCTA    1       406     0       495     lnu(C)_1_AY928180       SRR17232957.300718 300718/1     0       672
AACGGTGTTTCTACCAAGTATCTGAACAACTATCTTGTGTGGAATAACCTTGTAAATTACGCCAAAGAAAGCGACATGGAGAAAAGGAACATCTTCTTAACTTTCGTTTTGGCAACATTGAAAACTGCCAGCCGTGTAGATTGATCAAACAGACCAGCAGTTCCTCTGGTCGCTTAATTAGAATTTTGTAGATGATAAGATGGTCAATATAACAGATGTAAAACAGATTTTCAATTTGCAATAGATGCGGAGATTAAAGTCTTTCTTGCAGGCTGGGGTGGATGCTCTTCTGATATCAGTCGAGAGCCCATAATGATATTGACATTTTTGTAGAAAGAACGATTATCAGAACTTTATAGAAATAATGAAAGCTAATGGCTTTTTATGAGATTAAGATGGAATATACAATACGAACCATATCAGGCAAAGATTTTGAAAACAGAATTATTGATTTAAATGTTTTGAATATACGGACGAAGGTGAAATTCTTTATGATGGGGATTGTTTTCCGGTAGAAACTTTTCGGGTAAAGGAAGAATTGAGGAAATAGAGGTTTCCCGTATTGAACCATAGTCAATGGGCTGTTCCATCTGGGATACGAGTTTGATGAAAATGATGCCATGATGTACAGTTATTGTGAGACACTTCATATCGAAATTCCAATGAGGAGTGATAACTGCAAATAACAAGTTTGTAGGGGAGTTCTGATACCCCCTATAAAAATGGCTATTTATCAATCGTTGGTTGTGACATAGCCTTCATATAATATATCTTTGCATGGATTCCACGGCCTTACCCGTGTGTTTTTGCGAATCCACGATAACTCTTCAGGTCGCCTGACCTTCAAAAATTACCATGCAAAAA        1       341     0       495     lnu(C)_1_AY928180       SRR17232957.245932 245932/1     2528    3392

And a summary of the read-based ARG screening approach for all samples is stored as TSV table: results/resistance_genes-reads/summary.tsv.

$ head -2 results/resistance_genes-reads/summary.tsv
Sample  Gene    Score   Expected        Template_length Template_Identity       Template_Coverage       Query_Identity  Query_Coverage  Depth   q_value p_value
SRR17232957_1   lnu(C)_1_AY928180       7599    21      495     99.19   100     99.19   100     19.28   7535.38 1e-26

And a complete resistome dataset with ARG info, assembly statistics, taxonomy, and plasmid/virus predictions (CSV table with 39 columns) is saved as: results/assembly_database.csv.gz.

$ zless results/assembly_database.csv.gz | head -3
sample,arg,arg_identity,arg_length,arg_depth,contig,start_position,end_position,hit_length,arg_short,arg_coverage,Class,Phenotype,Resistance_mechanism,medical_importance,mean_assembly_depth_flye,mean_assembly_depth_samtools,total_assembly_length,contig_length,contig_depth_flye,circular,contig_mapped_percent,contig_depth_samtools,contig_mapped_reads,Species,Taxonomy,Species_strict,Taxonomy_strict,chromosome_score,plasmid_score,virus_score,plasmid_topology,plasmid_genes,conjugation_genes,amr_genes,virus_topology,virus_genes,virus_taxonomy,genomad_prediction
SRR17232957_1,lnu(C)_1_AY928180,99.19,495,2.02,contig_418,4000,4864,496,lnu(C),100.20202020202021,Lincosamide,Lincomycin,Enzymatic inactivation,HIA,5.768397033656589,7.170406012549915,18310891,22412,5,N,100,6.5833,67,Campylobacter coli,unclassified cellular organisms superkingdom;Campylobacterota;Epsilonproteobacteria;Campylobacterales;Campylobacteraceae;Campylobacter;Campylobacter coli,Campylobacter coli,unclassified cellular organisms superkingdom;Campylobacterota;Epsilonproteobacteria;Campylobacterales;Campylobacteraceae;Campylobacter;Campylobacter coli,0.7905,0.1618,0.0477,NA,NA,NA,NA,NA,NA,NA,chromosome
SRR17232957_1,lnu(C)_1_AY928180,99.19,495,2.02,contig_1422,15104,15802,496,lnu(C),100.20202020202021,Lincosamide,Lincomycin,Enzymatic inactivation,HIA,5.768397033656589,7.170406012549915,18310891,15802,4,N,100,4.42469,19,unclassified cellular organisms species,unclassified cellular organisms superkingdom;unclassified cellular organisms phylum;unclassified cellular organisms class;unclassified cellular organisms order;unclassified cellular organisms family;unclassified cellular organisms genus;unclassified cellular organisms species,,;;;;;;,0.9389,0.0446,0.0166,NA,NA,NA,NA,NA,NA,NA,chromosome

4. Antibiotic resistance mutations

Namaste screens metagenomes for the presence of antibiotic resistance-conferring mutations using MetaPointFinder. Its output is explained on GitHub.

Results are stored under results/resistance_mutations/{sample}/:

$ ls results/resistance_mutations/SRR17232957_1/
accession               SRR17232957_1.class.dna.summary.txt                            SRR17232957_1.frag.gz                SRR17232957_1.prot.input.tsv
class                   SRR17232957_1.class.prot.summary.txt                           SRR17232957_1.gene.dna.summary.txt   SRR17232957_1.prot.updated_table_with_scores_and_mutations.tsv
dna_accession           SRR17232957_1.dna.input.tsv                                    SRR17232957_1.gene.prot.summary.txt  SRR17232957_1.res
dna_class               SRR17232957_1.dna.updated_table_with_scores_and_mutations.tsv  SRR17232957_1.log
matched_to_contigs.tsv  SRR17232957_1.error                                            SRR17232957_1.prot.hits.txt

These results are combined in the end to make one big table with all mutations and contig annotations from the other analysis steps: results/mutation_database.csv.gz. (A table with 33 columns.)

$ zless results/mutation_database.csv.gz | head -3
sample,contig,class,gene,mutations,Unknown,Wildtype,Resistant,fraction_resistant,mean_assembly_depth_flye,mean_assembly_depth_samtools,total_assembly_length,contig_length,contig_depth_flye,circular,contig_mapped_percent,contig_depth_samtools,contig_mapped_reads,Species,Taxonomy,Species_strict,Taxonomy_strict,chromosome_score,plasmid_score,virus_score,plasmid_topology,plasmid_genes,conjugation_genes,amr_genes,virus_topology,virus_genes,virus_taxonomy,genomad_prediction
ERR10188468,contig_20,MACROLIDE,NZ_CP018347.1@23S_ribosomal_RNA@23S:32347-35250,None,1,NA,0,0,7.500926081831958,7.098058050597744,115259403,370730,26,N,99.9957,24.7572,2715,Streptococcus sp. LPB0220,unclassified cellular organisms superkingdom;Bacillota;Bacilli;Lactobacillales;Streptococcaceae;Streptococcus;Streptococcus sp. LPB0220,Streptococcus sp. LPB0220,unclassified cellular organisms superkingdom;Bacillota;Bacilli;Lactobacillales;Streptococcaceae;Streptococcus;Streptococcus sp. LPB0220,0.8733,0.0833,0.0434,NA,NA,NA,NA,NA,NA,NA,chromosome
ERR10188468,contig_20,MACROLIDE_STREPTOGRAMIN,NZ_CP018347.1@23S_ribosomal_RNA@23S:32347-35250,None,1,NA,0,0,7.500926081831958,7.098058050597744,115259403,370730,26,N,99.9957,24.7572,2715,Streptococcus sp. LPB0220,unclassified cellular organisms superkingdom;Bacillota;Bacilli;Lactobacillales;Streptococcaceae;Streptococcus;Streptococcus sp. LPB0220,Streptococcus sp. LPB0220,unclassified cellular organisms superkingdom;Bacillota;Bacilli;Lactobacillales;Streptococcaceae;Streptococcus;Streptococcus sp. LPB0220,0.8733,0.0833,0.0434,NA,NA,NA,NA,NA,NA,NA,chromosome

5. Taxonomic classifications

Namaste classifies contigs with Centrifuger and its database of microbiota + human. Centrifuger produces a table in TSV format and has a quant function to calculate microbiota profiles. Furthermore, Namaste uses both default and 'strict' settings and assigns scientific names to each using TaxonKit. All of these are stored as TSV files in results/taxonomic_classification/{sample}/.

For details on the file format, consult Centrifuger's documentation.

$ ls results/taxonomic_classification/SRR17232957_1/
centrifuger_masked-quant.tsv  centrifuger_masked-strict-quant.tsv  centrifuger_masked-strict+taxa.tsv  centrifuger_masked-strict.tsv  centrifuger_masked+taxa.tsv  centrifuger_masked.tsv

$ head -3 results/taxonomic_classification/SRR17232957_1/*
==> results/taxonomic_classification/SRR17232957_1/centrifuger_masked-quant.tsv <==
name    taxID   taxRank genomeSize      numReads        numUniqueReads  abundance
root    1       no rank 2070143 1696    1018    1.000000
Bacteria        2       superkingdom    4534370 1628    989     0.911828

==> results/taxonomic_classification/SRR17232957_1/centrifuger_masked-strict-quant.tsv <==
name    taxID   taxRank genomeSize      numReads        numUniqueReads  abundance
root    1       no rank 2070143 39      14      1.000000
Bacteria        2       superkingdom    4534370 39      14      1.000000

==> results/taxonomic_classification/SRR17232957_1/centrifuger_masked-strict+taxa.tsv <==
readID  seqID   taxID   score   2ndBestScore    hitLength       queryLength     numMatches
contig_1        unclassified    0       0       0       0       17948   1               ;;;;;;
contig_10       unclassified    0       0       0       0       5781    1               ;;;;;;

==> results/taxonomic_classification/SRR17232957_1/centrifuger_masked-strict.tsv <==
readID  seqID   taxID   score   2ndBestScore    hitLength       queryLength     numMatches
contig_1        unclassified    0       0       0       0       17948   1
contig_10       unclassified    0       0       0       0       5781    1

==> results/taxonomic_classification/SRR17232957_1/centrifuger_masked+taxa.tsv <==
readID  seqID   taxID   score   2ndBestScore    hitLength       queryLength     numMatches
contig_1        NZ_CP035464.1   78344   121     64      26      17948   1       Bifidobacterium pullorum        unclassified cellular organisms superkingdom;Actinomycetota;Actinomycetes;Bifidobacteriales;Bifidobacteriaceae;Bifidobacterium;Bifidobacterium pullorum
contig_10       NZ_CP102287.1   679190  100     0       25      5781    1       Hoylesella buccalis     unclassified cellular organisms superkingdom;Bacteroidota;Bacteroidia;Bacteroidales;Prevotellaceae;Hoylesella;Hoylesella buccalis

==> results/taxonomic_classification/SRR17232957_1/centrifuger_masked.tsv <==
readID  seqID   taxID   score   2ndBestScore    hitLength       queryLength     numMatches
contig_1        NZ_CP035464.1   78344   121     64      26      17948   1
contig_10       NZ_CP102287.1   679190  100     0       25      5781    1

Also, for each of these Namaste produces microbiota profiles as TSV in results/microbiota_profile/.

$ ls results/microbiota_profile/SRR17232957_1-*
results/microbiota_profile/SRR17232957_1-per_contig.tsv   results/microbiota_profile/SRR17232957_1-strict-per_contig.tsv
results/microbiota_profile/SRR17232957_1-per_species.tsv  results/microbiota_profile/SRR17232957_1-strict-per_species.tsv

$ head -2  results/microbiota_profile/SRR17232957_1-*
==> results/microbiota_profile/SRR17232957_1-per_contig.tsv <==
readID  seqID   taxID   score   2ndBestScore    hitLength       queryLength     numMatches      Species Lineage length  depth   total_bases     grand_total     Sample  Percentage
contig_282      NZ_LN879430.1   1679721 66113   52062   295     22345   1       Herbinix luporum        unclassified cellular organisms superkingdom;Bacillota;Clostridia;Lachnospirales;Lachnospiraceae;Herbinix;Herbinix luporum  22345   61.431  1372675.6949999998      132539452.71505 SRR17232957_1   1.0356732783189853

==> results/microbiota_profile/SRR17232957_1-per_species.tsv <==
Sample  Species Lineage total_bases     Percentage
SRR17232957_1   unclassified cellular organisms species unclassified cellular organisms superkingdom;unclassified cellular organisms phylum;unclassified cellular organisms class;unclassified cellular organisms order;unclassified cellular organisms family;unclassified cellular organisms genus;unclassified cellular organisms species        8955780.64689   6.757067773732448

==> results/microbiota_profile/SRR17232957_1-strict-per_contig.tsv <==
readID  seqID   taxID   score   2ndBestScore    hitLength       queryLength     numMatches      Species Lineage length  depth   total_bases     grand_total     Sample  Percentage
contig_282      family  186803  59536   59536   259     22345   1       unclassified Lachnospiraceae species    unclassified cellular organisms superkingdom;Bacillota;Clostridia;Lachnospirales;Lachnospiraceae;unclassified Lachnospiraceae genus;unclassified Lachnospiraceae species    22345   61.431  1372675.6949999998      132539452.71505 SRR17232957_1   1.0356732783189853

==> results/microbiota_profile/SRR17232957_1-strict-per_species.tsv <==
Sample  Species Lineage total_bases     Percentage
SRR17232957_1   NA      ;;;;;;  123421656.91637 93.1206930375044

In the end, per contig classifications of all samples are collected in two files: results/classifications-concatenated.tsv.gz and results/strict_classifications-concatenated.tsv.gz.

6. Plasmid predictions

Namaste uses geNomad to predict whether contigs derive from chromosomal DNA, plasmids or viruses. Per sample results are saved in results/plasmid_prediction/{sample}/.

$ ls -F results/plasmid_prediction/SRR17232957_1/
assembly_aggregated_classification/     assembly_annotate.log         assembly_marker_classification/     assembly_nn_classification.log  assembly_summary/
assembly_aggregated_classification.log  assembly_find_proviruses/     assembly_marker_classification.log  assembly_score_calibration/     assembly_summary.log
assembly_annotate/                      assembly_find_proviruses.log  assembly_nn_classification/         assembly_score_calibration.log

A detailed description of the outputs created by geNomad can be found in its documentation.

Output for contigs predicted to derive from plasmids and viruses are concatenated for all samples and saved under 'results': results/plasmid_predictions-concatenated.tsv.gz and results/virus_predictions-concatenated.tsv.gz.

$ zless results/plasmid_predictions-concatenated.tsv.gz | head -3
contig  length  plasmid_topology        plasmid_genes   genetic_code    plasmid_score   fdr     n_hallmarks     marker_enrichment       conjugation_genes       amr_genes       sample
contig_1753     4328    No terminal repeats     10      11      0.999   0.001   0       2.1513  NA      NA      SRR17232957_1
contig_1750     7896    No terminal repeats     11      11      0.999   0.001   0       0.8884  NA      NA      SRR17232957_1

$ zless results/virus_predictions-concatenated.tsv.gz | head -3
contig  length  virus_topology  coordinates     virus_genes     genetic_code    virus_score     fdr     n_hallmarks     marker_enrichment       virus_taxonomy  sample
contig_941      8070    No terminal repeats     NA      13      11      0.9989  0.0011  4       13.2017 Viruses;Duplodnaviria;Heunggongvirae;Uroviricota;Caudoviricetes;;       SRR17232957_1
contig_837      12674   No terminal repeats     NA      20      11      0.9989  0.0011  6       17.1828 Viruses;Duplodnaviria;Heunggongvirae;Uroviricota;Caudoviricetes;;       SRR17232957_1